Examples of DiffNode

de.danielbechler.diff.node.DiffNode
Represents a part of an object. It could be the object itself, one of its properties, an item in a collection or a map entry. A node may have one parent node and any number of children. It also provides methods to read and write the property represented by this node on any object of the same type as the original object. Last but not least, a node knows how the associated property has changed compared to the base object. @author Daniel Bechler
org.broadinstitute.gatk.engine.walkers.diffengine.DiffNode
Created by IntelliJ IDEA. User: depristo Date: 7/4/11 Time: 12:55 PM An interface that must be implemented to allow us to calculate differences between structured objects
org.eclipse.compare.structuremergeviewer.DiffNode

Examples of de.danielbechler.diff.node.DiffNode

    final ObjectWithNestedObject forBase = new ObjectWithNestedObject("differentchildid");
    forBase.setObject(new ObjectWithNestedObject("differentgrandchildid"));
    final ObjectWithMethodEqualsOnlyValueProviderMethodOnGetNestedObject working = new ObjectWithMethodEqualsOnlyValueProviderMethodOnGetNestedObject("id", forWorking);
    final ObjectWithMethodEqualsOnlyValueProviderMethodOnGetNestedObject base = new ObjectWithMethodEqualsOnlyValueProviderMethodOnGetNestedObject("id", forBase);


    final DiffNode node = objectDiffer.compare(working, base);


    NodeAssertions.assertThat(node).self().hasState(DiffNode.State.CHANGED);
    assertThat(node)
        .child(NodePath.with("object"))
        .hasState(DiffNode.State.CHANGED);

View Full Code Here

Examples of de.danielbechler.diff.node.DiffNode

    final Map<String, String> forBase = new HashMap<String, String>();
    forBase.put("keyone", "valone");
    final ObjectWithMethodEqualsOnlyValueProviderMethodOnGetMap working = new ObjectWithMethodEqualsOnlyValueProviderMethodOnGetMap(forWorking);
    final ObjectWithMethodEqualsOnlyValueProviderMethodOnGetMap base = new ObjectWithMethodEqualsOnlyValueProviderMethodOnGetMap(forBase);


    final DiffNode node = objectDiffer.compare(working, base);


    NodeAssertions.assertThat(node).self().hasState(DiffNode.State.UNTOUCHED);
    NodeAssertions.assertThat(node).self().hasNoChildren();
  }

View Full Code Here

Examples of de.danielbechler.diff.node.DiffNode

    final Map<String, String> forBase = new HashMap<String, String>();
    forBase.put("keyone", "valone");
    final ObjectWithMethodEqualsOnlyValueProviderMethodOnGetMap working = new ObjectWithMethodEqualsOnlyValueProviderMethodOnGetMap(forWorking);
    final ObjectWithMethodEqualsOnlyValueProviderMethodOnGetMap base = new ObjectWithMethodEqualsOnlyValueProviderMethodOnGetMap(forBase);


    final DiffNode node = objectDiffer.compare(working, base);


    NodeAssertions.assertThat(node).self().hasState(DiffNode.State.CHANGED);
    assertThat(node)
        .child(NodePath.with("map"))
        .hasState(DiffNode.State.CHANGED);

View Full Code Here

Examples of de.danielbechler.diff.node.DiffNode


    final NodePath nodePath = NodePath.with("reference", "reference");


    // verify that the node can be found when it's not excluded
    ObjectDiffer objectDiffer = ObjectDifferBuilder.startBuilding().build();
    final DiffNode verification = objectDiffer.compare(obj1, modifiedObj1);
    verification.visit(new PrintingVisitor(obj1, modifiedObj1));
    assertThat(verification).child(nodePath).hasState(DiffNode.State.CHANGED).hasChildren(1);


    // verify that the node can't be found, when it's excluded
    final ObjectDifferBuilder objectDifferBuilder = ObjectDifferBuilder.startBuilding();
    objectDifferBuilder.inclusion().exclude().node(nodePath);
    objectDiffer = objectDifferBuilder.build();
    final DiffNode node = objectDiffer.compare(obj1, modifiedObj1);
    node.visit(new PrintingVisitor(obj1, modifiedObj1));
    assertThat(node).child(nodePath).doesNotExist();
  }

View Full Code Here

Examples of de.danielbechler.diff.node.DiffNode

    final Map<String, ObjectWithString> working = Collections.singletonMap("foo", new ObjectWithString("bar"));


    final ObjectDifferBuilder objectDifferBuilder = ObjectDifferBuilder.startBuilding();
    final ObjectDiffer differ = objectDifferBuilder.build();


    final DiffNode node = differ.compare(working, base);


    node.visit(new NodeHierarchyVisitor());


    assertThat(node).child(NodePath.startBuilding()
        .mapKey("foo")).hasState(DiffNode.State.ADDED);


    assertThat(node).child(NodePath.startBuilding()

View Full Code Here

Examples of de.danielbechler.diff.node.DiffNode

  public void detects_change_from_null_to_object_referenct_as_addition() throws Exception
  {
    final ObjectWithString base = new ObjectWithString();
    final ObjectWithString working = new ObjectWithString("foo");


    final DiffNode node = ObjectDifferBuilder.buildDefault().compare(working, base);


    assertThat(node).child("value").hasState(DiffNode.State.ADDED);
  }

View Full Code Here

Examples of org.broadinstitute.gatk.engine.walkers.diffengine.DiffNode

        Assert.assertNotNull(diff);


        Assert.assertEquals(diff.getName(), vcfFile.getName());
        Assert.assertSame(diff.getParent(), DiffElement.ROOT);


        DiffNode node = diff.getValueAsNode();
        Assert.assertEquals(node.getElements().size(), 11);


        // chr1    2646    rs62635284      G       A       0.15    PASS    AC=2;AF=1.00;AN=2       GT:AD:DP:GL:GQ  1/1:53,75:3:-12.40,-0.90,-0.00:9.03
        DiffNode rec1 = node.getElement("chr1:2646").getValueAsNode();
        testLeaf(rec1, "CHROM", "chr1");
        testLeaf(rec1, "POS", 2646);
        testLeaf(rec1, "ID", "rs62635284");
        testLeaf(rec1, "REF", Allele.create("G", true));
        testLeaf(rec1, "ALT", Arrays.asList(Allele.create("A")));

View Full Code Here

Examples of org.broadinstitute.gatk.engine.walkers.diffengine.DiffNode

        Assert.assertNotNull(diff);


        Assert.assertEquals(diff.getName(), bamFile.getName());
        Assert.assertSame(diff.getParent(), DiffElement.ROOT);


        DiffNode node = diff.getValueAsNode();
        Assert.assertEquals(node.getElements().size(), 33);


        // 30PPJAAXX090125:1:42:512:1817#0 99      chr1    200     0       76M     =
        // 255     -130    ACCCTAACCCTAACCCTAACCCTAACCATAACCCTAAGACTAACCCTAAACCTAACCCTCATAATCGAAATACAAC
        // BBBBC@C?AABCBB<63>=B@>+B9-9+)2B8,+@327B5A>90((>-+''3?(/'''A)(''19('7.,**%)3:
        // PG:Z:0  RG:Z:exampleBAM.bam     SM:Z:exampleBAM.bam


        DiffNode rec1 = node.getElement("30PPJAAXX090125:1:42:512:1817#0_1").getValueAsNode();
        testLeaf(rec1, "NAME", "30PPJAAXX090125:1:42:512:1817#0");
        testLeaf(rec1, "FLAGS", 99);
        testLeaf(rec1, "RNAME", "chr1");
        testLeaf(rec1, "POS", 200);
        testLeaf(rec1, "MAPQ", 0);

View Full Code Here

Examples of org.eclipse.compare.structuremergeviewer.DiffNode

            return super.compare(viewer, e1, e2);
        }


        private ErlNode getErlNode(final Object e) {
            if (e instanceof DiffNode) {
                final DiffNode d = (DiffNode) e;
                final ITypedElement left = d.getLeft();
                if (left instanceof ErlNode) {
                    return (ErlNode) left;
                }
                final ITypedElement right = d.getRight();
                if (right instanceof ErlNode) {
                    return (ErlNode) right;
                }
            }
            return null;

View Full Code Here

Examples of org.eclipse.compare.structuremergeviewer.DiffNode

          throw new InvocationTargetException(
              new IllegalStateException(
                  UIText.GitCompareEditorInput_ResourcesInDifferentReposMessagge));
        String repoRelativePath = map.getRepoRelativePath(resource);
        filterPathStrings.add(repoRelativePath);
        DiffNode node = new DiffNode(Differencer.NO_CHANGE) {
          @Override
          public Image getImage() {
            return FOLDER_IMAGE;
          }
        };

View Full Code Here

0 1 2 3 4 5

TOP

All source code are property of their respective owners. Java is a trademark of Sun Microsystems, Inc and owned by ORACLE Inc. Contact coftware#gmail.com.